Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ559401
Length 475 bp
Fasta Format > rwhkp8b12
aatatcacacaggttttgtatatgtgtagccggttctagaatttacatat gcatgctcgagaacctatgttcgtacatacacacacagaccatatagaat gaaaaatatgctctggtcgtccagcagagtggtggacaaaagttaagttc acaaaagaccttcatacataggccattgtttcaactcgtagtttaggcct tgccagactcctcgcaacccggtggcctgaaggcgatgaagctgacgcac tgcacctggcgcaggttgtcgaagccgatgacgcggacataggcgtcagg gtactccttcttgacctcctccacctcgttgagcacctgtgtggcgtcgg tgcacccgaacataggcagcttccacattgtccagtatcgaccatcgtag tacccgggggagctgttgtgctcacggaaaacgaagccaaccttgctgaa ctcgaggcagggcacccacttggag
Download
page-top