Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ559234
Length 866 bp
Fasta Format > rwhkp7i13
ctctttttcctatctgatgatggtgatctctgtgatacaacgtatggctt gacagtgaaaggcacctatgcattgcaaaccacgacaatggtgaagaaaa aaaagatgttacacagcgtaacaacaagctcatactccggttcttcatgc tgctacggctacaggtcttttgctggtcttgattcctttgatagcttcag catagtctttagctccgaaaaccgcagaaccagcaacaagggcattcgcg ccagcttcaatgaccttgtaggcatttttggggctgactccaccatcaac ctcaatccaggggttcactcccttctcttcacataattttctcaaatcag caattttctttacttggctctcaatgaagctttgcccaccaaacccaggg ttgactgacataatcaataccagatcaacagattcaagtacatattctat cgcactgagtggggtcccagggttcaaaacaactccagcctttgctccta gacttttaatctgatcgactgttcggtgcagatggatggttgccgtttgc tcacagtggacgctaacaatatcagcacctgccttgataaaatcaggaat tcgctgctcaggttccacaatcatcagatgcacatccaatggaagatcag tcactggacgcagagcatcaacaatcaatggtccaatcgtgatgtttggc acaaagcgaccgtccatgacatcaacatgaatccagtcacatcctgccac ctccacagcttttacctgttcaccaagcttgggcgaagtttgcagagaga atggaaggggacacaatgatgtcactcttgggagaaactgtcgacccttg atgccttcacttggaa
Download
page-top