Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ559126
Length 782 bp
Fasta Format > rwhkp7b20
agatctcgtccattgatgtattcgggggttgtgccgaagaagaagatata gacctatgaggaattacgtatgcatgctcaagaacctatgttcgtacata catacacaaaatcatatagaacaaaaggtatgctccggtcagaaagcaga gtcgtacagcagagttttggacaaaagtgaagttcacaaaagaccttcat acgagataggccattgtttcaactcgtagtttaggccttgccggactcct cgcaacccggtggcctaaaggcgatgaagctgacgcactgcacctggcgc aggttgtcgaagccgatgacacggacataggcgtcagggtactccttctt gacctcctccacctcgttcagcacctgtgtggcgtcagtgcacccgaaca taggcagcttccacattgtccagtatcggccgtcgtagtacccgggggag ctgttgtgctcacggaagacgaagccaaccttgctgaactcgaggcaggg cacccactttgagcggatcaggtagtcgacctgtttcaggagggcctccg tggataggggtggcaggtaagacagggtctcgaacttcttgatgccctca attggccacacctgcatgcacctgatccttccgccattgctgacgctgct gaggctgccgctggagcggcggccgacggggagaccggctgtggacttga gcccctggaagggtgcgacggtggtagccgaggaagccatcacggcgggg gccatggtaatgtattatctggaggagaggag
Download
page-top