Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ559038
Length 858 bp
Fasta Format > rwhkp6n01
tggaccacagaggaatagttcaatatacagggcaggcaagaagtaattca aactgctaaacaccacaaggccaacacaaagtattccccattgctacaca aagtgggattaaagcttgacagggcttgatgtcagaccaacactagcagg gacgccaaagcttttatttctgtaaggagggctcctacgaatggagggat ttggctttggagaacagcttcgcgcgcttgaggagtcccgagggtcactc gaccaccatgctctcggcctccttcttgatggagtggaagagcaccgacg aaaggtagcgctctccgaagcttgggaatacaacaacaaagagtttccct gcattttcaggcctctgagcaaccttgattgcagctgctgcagcagcacc agaagagattccaaccagcaatccttctttcaatgccagagactttgcca tctcaatggactcatcacttgaaacctgtatggtttcatcaatgatgtca acatccaagacaccagggataaaaccagctccaattccttggatcttgtg tggtccaggctttccaccatttaagacagcactctcggtaggctccacac cgtagagcttgatgttaggattttgctctttgaggtattttccagatcca gtaatggtaccacctgtcccgatgccagaaacaaggccatcgatctttcc tcctgtgcctttccagatttcaggcccagttgtctcatagtgaatctttg ggttggcagcattctcgaactgctgaaggatgtatgagttaggtgtcttt gctgccagctcttccgccttttggacagctcctttcattcccaanagtgg gtcggtga
Download
page-top