Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ559026
Length 887 bp
Fasta Format > rwhkp6m08
atatatagtagcaacattaactgacgaagtttcaccaacacaaccgaacg atacaatgacagagcaataagcagttccaacactgctcgacacaaataac cgaagcttaacaagtttccaaaacaactagaacaactatcaccaccacca aataccgccaccgccaccatagatgcagtaaagaacctgacaccatctca tttcttcttggccgcagccttggtcaccttggcaccggtcggatccttct tctccacagccttgataacacccacggcaaccgtctgcctcatgtcacgc acagcaaagcggcccaggggagggtactgggcaaaggtctccaccaccat gggcttggtggggatcatcttgacgaacccagcatcaccgttcttgagga acttgggcgccgcctcaatctccttgccagaccgccggtcgatcttggtc tggatctcagcaaacttgacagcaatgtgggacgtatggcagtccagcac cggggcatagccgttgctgatctggccggggtggttcatgatgatgacct gggcggtgaagttggcagcctccttggcagggtcgtccttggagttggaa gcgacgtacccacgcttgagatccttgacagccacgttcttgacgttgaa gccgacgttgtcaccaggaagcgcctccaggagagactcatggtgcatct caacggacttcacctcagtggtcaggccagtaggaccaaaggtgacaacc atgcctggcttgatgactccagtctcaacacggcccactggcacagttcc aatgccgccaatcttgtacacgtcctgaaggggaagacggaggggcttgt ctganggcctcttgggctcattgatctggtccagggc
Download
page-top