Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ558609
Length 604 bp
Fasta Format > rwhkp5e04
aacatcaatacaacagtgtggcctgccatgcagagctggccggacgtagg tactcctctcgctgtcacgcagtgagataatatgagagcacttattcata tatatgtatatgtatgtgtatgacctcaacgtactcagcgtagatcgctg gagctatatgcagcgatgatgagaagaagtggtcgatcaacgaatcttag aacagtccacagatgagctgatggcgtaggggacgctgacgccgcacttt aaagggatgccggcggccttgccagcgttgagcccaccagcagcgctctt gatgcacttgcacgctgcttgcttgtcagcggtgcttcgggctgcaccgg ccagactcctgacgccgctgcagcaggccgcaggcgggttggcgccattg ccgcgtgcataggagatgcaggggctcaaggcagaggtcacctgaccgca ggatatcgccgcatcgcaggctacgaggagcatagcggccaccatggaga ccagcacgagctgagtagctgcaccgcgagccatccctattgagtttgca gtagtagtggtgttgagctcagctggagatggtgagatgggctagatttg ctaa
Download
page-top