Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ558546
Length 812 bp
Fasta Format > rwhkp5a13
acaggttttcccattgtataagcagcaaaattacacgaccatagtagaac aaaaaccaccgctccgatttacgatacgcagcacccgagtaacagggtat tcgactccaaaaacgaaactacctaagctattttgagagcacaagttcca tactaggttcgatatccgaaggatatatcaagactctgaaaaccaaacga taatactggtaagcaggacacccaaacaggccaccgcaccgaaggcagat cagtacttgtagtccttgacgtggaggctctcagaggccccctcgccgag ggtggcatcgcccttgtaggtgccgagggtggcctcagagttggccttgc acctcaccaggaacgccttcctggccttctcctcgttctccaccttgcca gcccaggccttgagggtgctctgctggagggcacgcccgaaggagaagga caggttccatggcttcttggtctcgagcttgttcatggcgttcaggttca gggtcgcctcctcctcgctctgtccaccagagaggaagacaatggctggg acggcagcagggacagtcctctggagggtgcggacggtgtactcagcaat cacctcaggggccaccttcttggcgtcggatccaggggtgaccatgttgg gcttcaggagggtgccctcaaggaggacatgctggtcgttgagggccttg tagcacgcagcaaggaccatctcagtcacgtaagcacagcggtcaatgtc atgaggtccatcaacaaggatctcaggctcaacaatgggcaccagcccat tctcctggcaga
Download
page-top