Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ558507
Length 609 bp
Fasta Format > rwhkp4o03
agtacaaaaggggatcaagatggccagcagatagaatcagatctcatctt gtagagggagatttccttatatctacactaaacagcaatcacatgcgtcc aagcttaaatatgcagtgatacaagcaaacacaggcccaaacttattgcc caattcgtatttacaaggcactagagaaaagaaattatatgtgggctcag aaacttttgctgttttcacctccatcttgtctaaataaaaaatctggaca taacttttctaccctctgctagtcattcctggagtttgtacggagcaagt cactcggaaaccccatccttcagcttatttcagactcgtactgatgtcga ccaagaaggtgatggaactacaaaaattgtttccaatgcataataccaca tcgtgagcgcgagcagaccatacttacaatcttatacttgatctgagcag gtagtttgtgcattggcgacaaccttgctcacattggaagacagctttcc tcttagctcagcacagacaagatgtgtcaagaggagcccagcaagaagtg ctgctgccatcaacatcgtgaacacggcactccagctctctgttgagatg tatcctgtg
Download
page-top