Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ558227
Length 324 bp
Fasta Format > rwhkp3o09
gcttttccccagaagtacgctcattgtggcagacgcagcaaaccacctag agctaatagtttattcagagagcaatagcctggccggctgcttcacagta accaaacgacaaactgacagtcagaacaaattccacagatggaatagcga cagcaaatcatgtcttcactcgcacagcaccgcgccctcttccagagaat cctcctccgcccgccatgcgaggaggttggcgagcttgccttccttgacc agagggtggctgtgcacactctcggcctcgaagcagtggaagacggacct gggcgacccggcagagacagcaac
Download
page-top