Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ558135
Length 862 bp
Fasta Format > rwhkp3j06
aatagtgtagagaagatatgttttaagcgatacaatagtactcatacttg tcacgctaaatgatggaaacttttctgatacaggcaaaactttggggttg tctagatctccaaagagccgagagaatgaaaagacagaaaatctagagac cagcccttttcttcaagtgttgcttgaaatccatgatatcgccttcccac ctagtcaccgcctggttctcacagacccagatctcttgagcaacctgatt gatcagcctgaagtcatggctcaccaggaccaaccccccgtcccattcct tcagtgcctcagcaagtgagtcaatggtctcaatgtcaagatgatttgtc ggctcatcaagcaacagcatctgtggctgcctaaatgctagccaagcaaa aatgacacgggccttctgcccatcagacaggtttttcattggcatcacct gtgcctttcctgacaggccaaacttgccaattgcagctctcatcttctcc tcttcattcccagggtactccctcatcatgtactgcagggccggcatgtc caggtccagcttctcagtgagatgttgatggaattgtgcaatgcgtaggt ggttgtggcgtctgaccatgccatccaacggagataggtcacctgtcatg agcttcagaagtgtgctcttaccagccccattgggaccgaccagtgcaac tctcgagtcaaggtcaacaccgaagtcaaggttcttgtagatgagattat ccggagtgtaaccaaatgtgacatcagcaaactgcagcactggtggtggg agtttgccaacatctgtaaagcggaatacaagaatcctgtcattgacaac cttctcagcaag
Download
page-top