Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ557999
Length 521 bp
Fasta Format > rwhkp3b24
gacagatctcgtccattgatgtattcgggggttgtgccgaagaagaagat atagacctatgaggaattacgtatgcatgctcaagaacctatgttcgtac atacatacacaaaatcatatagaacaaaaggtatgctccggtcagaaagc agagtcgtacagcagagttttggacaaaagtgaagttcacaaaagacctt catacgagataggccattgtttcaactcgtagtttaggccttgccggact cctcgcaacccggtggcctaaaggcgatgaagctgacgcactgcacctgg cgcaggttgtcgaagccgatgacacggacataggcgtcagggtactcctt cttgacctcctccacctcgttcagcacctgtgtggcgtcagtgcacccga acataggcagcttccacattgtccagtatcggccgtcgtagtacccgggg gagctgttgtgctcacggaagacgaagccaaccttgctgaactcgaggca gggcacccactttgagcggat
Download
page-top