Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ557846
Length 762 bp
Fasta Format > rwhkp2j02
agtagcaacnttaactgacgaagtttcaccaacacaaccgaacgatacaa tgacagagnaataagcagttccnacactgctcgacacaaataaccgaagc ttaacaagtttccaaaanaactagaacaactatcaccaccaccaaatacc gccaccgccaccatagatgcantaaagaacctgacaccatctcatttctt cttggccgcagccttggtcaccttggcaccggtcggatccttcttctcca cagccttgataacacccacggcaaccgtctgcctcatgtcacgcacagca aagcggcccangggagggtactgggcaaaggtctccaccaccatgggctt ggtggggatcatcttgacgaacccagcatcaccgttcttgaggaacttgg gcgccgcctcaatctccttgccagaccgccggtcgatcttggtctggatc tcagcaaacttgacagcaatgtgggacgtatggcagtccagcaccggggc atagccgttgctgatctggccggggtggttcatgatgatganctgggcgg tgaanttggcancctccttggcagggtcgtccttggagttggaagcgacg tacccacgcttgagatccttgacagccacgttcttgacgttgaagccgac nttgtcaccaagaagcgcctccaggagagactcatggtgcatctcaacgg acttcacctcagtggtcagggccagtaggaccaaaggtgacaaccatgcc ctggcttgatga
Download
page-top