Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ557845
Length 827 bp
Fasta Format > rwhkp2j01
gtagcaacattaactgacgaagtttcaccaacacaaccgaacgatacaat gacagagcaataagcagttccaacactgctcgacacaaataaccgaagct taacaagtttccaaaacaactagaacaactatcaccaccaccaaataccg ccaccgccaccatagatgcagtaaagaacctgacaccatctcatttcttc ttggccgcagccttggtcaccttggcaccggtcggatccttcttctccac agccttgataacacccacggcaaccgtctgcctcatgtcacgcacagcaa agcggcccaggggagggtactgggcaaaggtctccaccaccatgggcttg gtggggatcatcttgacgaacccagcatcaccgttcttgaggaacttggg cgccgcctcaatctccttgccagaccgccggtcgatcttggtctggatct cagcaaacttgacagcaatgtgggacgtatggcagtccagcaccggggca tagccgttgctgatctggccggggtggttcatgatgatgacctgggcggt gaagttggcagcctccttggcagggtcgtccttggagttggaagcgacgt acccacgcttgagatccttgacagccacgttcttgacgttgaagccgacg ttgtcaccaggaagcgcctccaggagagactcatggtgcatctcaacgga cttcacctcagtggtcaggccagtaggaccaaaggtgacaaccatgcctg gcttgatgactccagtctcaacacggcccactggcacagttccaatgccg ccaatcttgtacacgtcctgaagggga
Download
page-top