Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ557704
Length 865 bp
Fasta Format > rwhkp2b11
gcgagcaggttcatacaacacaacaggttgtaaaccaaacaccccacagc aaacattcaattcaaacagacagaaaacagataaagccactcgggcagat catcaggtcgcaatctcagctgctctagtactcatcaccctcatcaccat cctcaccctcgtcgaactcagcaccaacttcttcatagtccttctccagg gcagcgagatcctcacgggcctcagagaactctccctcctccatgccctc acccacgtaccagtggacgaaggcacgcttggcgtacatcaggtcgaact tgtggtcgatgcgggagaagacctcgacaacgctggtggagttggagatc atgcagacggccctctggaccttggcaaggtcgccgcctgggacgacgct gggtggctggtagttgataccacacttgaaaccagtggggcaccagtcca caaactggatggtgcgcttcgtcttgatggtggccacagcggcgttgaca tccttgggcacaacatcaccacggtacatgaggcagcaggccatgtactt gccgtggcgggggtcacactttgccatcatggaggaaggctcgaaggcgc tgttggtgatctcggcaacagagagctgctcatggtaagccttctcggct gagatcactggggcgtaggaggaaagcatgaagtggattcttgggtaggg caccaggttggtctggaactcgttgacatcaacattcagagcaccatcaa acctcagggaagcagtcagggatgagatgacctgagaaaacgagcctgtt gaggttggtgtatgttgggcgctcaatgtcagggnagcggcggcagatgt catanatggcctcat
Download
page-top