Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ557685
Length 873 bp
Fasta Format > rwhkp2a09
tgtgagccccacttacataacatcagcatctacagaatcgcttgcatgtt tgacaataatatgcgatggtgcagtaaaagctcgttctgttcacaatgaa agcatgacaggtaatggcgacataaccaaaatgacttgaatcgatgagta atgactattcaagcattgaagtggaagaggtctttcacagtcttgatttg agctcagcagcaacagcgtcaatgaactcttcagtgttcaggtaatcgct tcttgtaacttttgaggatccatggacaaggagtgcaaggtccttggtca tcttcccagactccacagttccgacgcacgcttcctcaagtttctgtgca aattcaagaagtctagcattctcgtctagctttgccctgtgtgcaagtcc tcttgtccaagcaaagattgaagcaatgctgtttgtgctggtttcaccac ctttctggtgaacacggaaatggcgggtaactgtgccatgggcagcttca gcttcgatggttttaccatcagggcacatcaatactgacgtcatcaagcc caaagagccaaaaccttgagctaagaaatcactctgcacatctccgtcat agttcttgcaagcccaaacatagcctccttcgctcttaagtgcataggca accatgtcatcgatgagacgatgttcataccatattccagcagcctcata tttggatttccagccagcttcatagatctcctggaaaatgtccttgaacc tgccatcatatttcttaaggattgtgttttttgtgctaaggtacaatggc catttcttctcataagcgattgccatanaagcttcancaaaacctcgaaa ttgactcatctgtgttgtacata
Download
page-top