Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ557150
Length 660 bp
Fasta Format > rwhkp1d11
actgtcctgtaaatcatcaggcaaaaggggagctacaagcctcattcata cacacttggaaaaccagcgaaaaggagcatgcatcgcgatgtgcggctgt tctgggtggagacgagagtttctaaagagcggaaggtttcatttattcaa aacatccagaggagcagctgcccttcgaatgtggatttacgccaggcatg agtaggccaacgccttctcctctgacagctcctgggcggtcgcatccatc ttcttcctcgagaactcatcgatcgggagcccttgaacaattgtccattc accaccactgcacgttactgggaaggagtagataagaccagcaggcacac cgtatgaaccatcagagtacacacccatggaaacaaatgttccctcagcg gttcccagaacccagtcacggatgtgatcacaagctgagctggcagcaga gagagcactggagagcttcctcgctttgatgattgcagcaccacgctgct ggacagtggcaatgaactccccatttagccattcatcatcttgaacaagt tcacgaacaggcttctctccactgggagtcttcacagtggcatggttaac atcaggatactgactggacgagtgattaccccagataatagcattcttaa cgtcagaaac
Download
page-top