Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ557142
Length 659 bp
Fasta Format > rwhkp1c24
ctgtcctgtaaatcatcaggcaaaaggggagctacaagcctcattcatac acacttggaaaaccagcgaaaaggagcatgcatcgcgatgtgcggctgtt ctgggtggagacgagagtttctaaagagcggaaggtttcatttattcaaa acatccagaggagcagctgcccttcgaatgtggatttacgccaggcatga gtaggccaacgccttctcctctgacagctcctgggcggtcgcatccatct tcttcctcgagaactcatcgatcgggagcccttgaacaattgtccattca ccaccactgcacgttactgggaaggagtagataagaccagcaggcacacc gtatgaaccatcagagtacacacccatggaaacaaatgttccctcagcgg ttcccagaacccagtcacggatgtgatcacaagctgagctggcagcagag agagcactggagagcttcctcgctttgatgattgcagcaccacgctgctg gacagtggcaatgaactccccatttagccattcatcatcttgaacaagtt cacgaacaggcttctctccactgggagtcttcacagtggcatggttaaca tcaggatactgactggacgagtgattaccccagataatagcattcttaac gtcagaaac
Download
page-top