Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ555005
Length 666 bp
Fasta Format > rwhkp12o20
aacaataacagaagctaaaatataaaccgacaccctgggtttagattact agatacacacacaaacacacattgttgcctcgattgtttcctctccaccg atcaacccacgtacgcatgcacacaagatgagtatcttcacttctgctct gctctagttagactcgagctgcgcgtaccacacaccctggatcttgacat ccttgggcgccttggcgccgaggtcggtgtctgacggctgcacgctctcg aagacgccgatcacctcgccggtctccggcttgctcttggtgacgctgag cgtgatgttgcccgtggaggaggacgcgttcttcacgttctccttggcca actcctcctcgtctcctctgcctccggcgggtagcgccacggcgttgtcg tagccagtagagccaccacggccctttgggtcgaggaaagacgaacccct gtagctgggcacgaggaagggcccgctgaagctctcgggcttgccggtgg cgacgagctgcttgacggtgaagaggaagggcacgcgctcgcctccgggg agctgcacggtgacggccgcgtagtcgatgccgtccttctcctcgaactt gagggtgccgtcggcgccgacctcgagcgggccttccatctcgtcaaggg tgtaggtgagacgggt
Download
page-top