Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ554940
Length 726 bp
Fasta Format > rwhkp12l11
aacaataacagaagctaaaatataaaccgacaccctgggtttagattact agatacacacacaaacacacattgttgcctcgattgtttcctctccaccg atcaacccacgtacgcatgcacacaagatgagtatcttcacttctgctct gctctagttagactcgagctgcgcgtaccacacaccctggatcttgacat ccttgggcgccttggcgccgaggtcggtgtctgacggctgcacgctctcg aagacgccgatcacctcgccggtctccggcttgctcttggtgacgctgag cgtgatgttgcccgtggaggaggacgcgttcttcacgttctccttggcca actcctcctcgtctcctctgcctccggcgggtagcgccacggcgttgtcg tagccagtagagccaccacggccctttgggtcgaggaaagacgaacccct gtagctgggcacgaggaagggcccgctgaagctctcgggcttgccggtgg cgacgagctgcttgacggtgaagaggaagggcacgcgctcgcctccgggg agctgcacggtgacggccgcgtagtcgatgccgtccttctcctcgaactt gagggtgccgtcggcgccgacctcgagcgggccttccatctcgtcaaggg tgtangtgagacgggtcatgagcttggtcttctggaaggccggcggctcg ttcttctggatgccctcngccttgac
Download
page-top