Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ554927
Length 684 bp
Fasta Format > rwhkp12k18
gcttttccccagaagtacgctcattgtggcagacgcagcaaaccacctag agctaatagtttattcagagagcaatagcctggccggctgcttcacagta accaaacgacaaactgacagtcagaacaaattccacagatggaatagcga cagcaaatcatgtcttcactcgcacagcaccgcgccctcttccagagaat cctcctccgcccgccatgcgaggaggttggcgagcttgccttccttgacc agagggtggctgtgcacactctcggcctcgaagcagtggaagacggacct gggcgacccggcagagacagcaacctcttcgttcacggtaaagctctggt agatgaggacgcctccacaggggagctcctgctccacaacgttgttgcag tcgtatgcctcggcgtcgagcttcttgccccaggtggcggcgtggccgcg gccaccaaagatggtgaccgccgcagagaactctgaagggccaaagcacc ggaggaccctcttgacgatgtcgccgtaggccagggcggaggcgtccatg cccatgacctcgtagctcgcatagctgaagccgtcctcgggggtcacatg gatggtggagacggcagatccgttgatggcgttcatggagtagccgcagg gctcgaagtcgaagtcacagacctccatctcggg
Download
page-top