Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ554849
Length 578 bp
Fasta Format > rwhkp12g16
atggtccgcgtgtttgtatataataaatatcacacaggttttgtatatgt gtagccggttctagaatttacatatgcatgctcgagaacctatgttcgta catacacacacagaccatatagaatgaaaaatatgctctggtcgtccagc agagtggtggacaaaagttaagttcacaaaagaccttcatacataggcca ttgtttcaactcgtagtttaggccttgccagactcctcgcaacccggtgg cctgaaggcgatgaagctgacgcactgcacctggcgcaggttgtcgaagc cgatgacgcggacataggcgtcagggtactccttcttgacctcctccacc tcgttgagcacctgtgtggcgtcggtgcacccgaacataggcagcttcca cattgtccagtatcgaccatcgtagtacccgggggagctgttgtgctcac ggaaaacgaagccaaccttgctgaactcgaggcagggcacccacttggag cggatcaagtagtcgacctgcttcaggagggcctccgtggagaggggtgg caagtaagacagggtctcgaacttcttg
Download
page-top