Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ554550
Length 871 bp
Fasta Format > rwhkp11g06
aacttggtcagactttaggaagtttgacttcagtcaactctaatatgcga agtaaataaaaacagagggagtacagaagatatatatgtgcatcctcgca gtcgcagacaactggaaaaggaaaattatctttctgtgctgcctcttttt ccctatctgatgatggtgatctctgtgatacaacgtatggcttgacagtg aaaggcacctatgcattgcaaaccacgacaatggtgaagaaaaaaaagat gttacacagcgtaacaacaagctcatactccggttcttcatgctgctacg gctacaggtcttttgctggtcttgattcctttgatagcttcagcatagtc tttagctccgaaaaccgcagaaccagcaacaagggcattcgcgccagctt caatgaccttgtaggcatttttggggctgactccaccatcaacctcaatc caggggttcactcccttctcttcacataattttctcaaatcagcaatttt ctttacttggctctcaatgaagctttgcccaccaaacccagggttgactg acataatcaataccagatcaacagattcaagtacatattctatcgcactg agtggggtcccagggttcaaaacaactccagcctttgctcctagactttt aatctgatcgactgttcggtgcagatggatggttgccgtttgctcacagt ggacgctaacaatatcagcacctgccttgataaaatcaggaattcgctgc tcaggttccacaatcatcagatgcacatccaatggaagatcagtcactgg acgcagagcatcaacaatcaatggtccaatcgtgatggtttggcacaaag cgnaccgtccatggacatcaa
Download
page-top