Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ554315
Length 867 bp
Fasta Format > rwhkp10i24
tacttctctagaacatattacagatcagccatggcaatctcaattctcag gcgagggttagtacaggggagggtgaaccggttacattgtcaagcttgca tcgcagcatactactactcagctacacaggtcaacagggtggactggtca tacatcacgtcttccaacaaccataatatagttcatcacgctcgcatgcc tgcccaaccaacatccccaggagaaatgcgcacttgtcgatgcaattcca acgactcgtgagacaaacatctcatagtcatgcatgggggctctgctttc tcgcgtgttctgggatcaattttgccgcaacatccgctgggattcctttc agttccgggtcccgaagctcatcaaagaaggggtgaacaagtgcctccac agcagtgcatcttaggttgggcgagtactggaggagccgagagactanat caacagcttcaggtggcatccttttatggaataccttgtgccatgggtgt gctttaatctgtgggaatttgaactccgtataattggggttcatgcattt aatttcttcccttgtangagtaccaaggaccttgatgatttcaacaagct ggtccacaccactttcaccaggaaacagaggctgccctagcataagctca gcaagaacacatccagcagaccaaatgtcaatggctgtagtgtactcggt agcaccaaatatgagctctggagccctatagtatcgggaacaaatgtacg atatgttcggttctcccttaacaagaacttttgcactcccaaagtcacac agttttcagctggtgagtgtgtgggtttaccaaaaagatttttgcggctt gatatccctgtggcaaa
Download
page-top