Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ554221
Length 842 bp
Fasta Format > rwhkp10e09
tcaaatgccatagatagtgatattacatgataaaacaacaaaaataaaag aaatatatcaagccacaagatagcatcaatcaagaaaaatgcgcgggagg aagaaatttagccaagaaacaccgatgactgaaactagtagtggaattca tttgccttcttgaaaaccccagcttgggcagaagcagcaccatcagaggt cacggccacgacgatacagtccttcacctgctgggtggtaaatgggaact tcttgttcacaatggagttgaggtatgcagctgccccctcacgtatcagg gcgccaataccatcagttctagtgtttgagagtgcatcatgcatatttcc tagcttcttgccacctatcatactgcatgcagcaccaaatgtcttgccga tgttgccgagggacccaatagctgcaactatagcatctgggtgattcttc cagtagtcgcaggatccaatgaacccatgcttctttggacttgcagggac atcatgggaaggtgcacttggggtgctcggtgtagtgccataagatggcg tcggtgtagtgccgtaagatggcgtcggtgtagtgccgtaagttggcgtc ggtgtaatgccgtaagttggtgtcggtgtagtgccgtaagatggcgtcgg tgtantgccgtaagttggtgtcggtgtcagtgtcgggttgtancctcctc ctgacccatgcntgggagttgatgancccccatantgggtcttctgctca tgcaactctcccangctcctgcacnanctcnntgnaacnanccccnccna nacngcnctcntcnnaanaaccttgccncccntattgctctc
Download
page-top