Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ554200
Length 864 bp
Fasta Format > rwhkp10d10
caattttatcaactcgacgtatttacaagtacaaaaggggatcaagatgg ccagcagatagaatcagatctcatcttgtagagggagatttccttatatc tacactaaacagcaatcacatgcgtccaagcttaaatatgcagtgataca agcaaacacaggcccaaacttattgcccaattcgtatttacaaggcacta gagaaaagaaattatatgtgggctcagaaacttttgctgttttcacctcc atcttgtctaaataaaaaatctggacataacttttctaccctctgctagt cattcctggagtttgtacggagcaagtcactcggaaaccccatccttcag cttatttcagactcgtactgatgtcgaccaagaaggtgatggaactacaa aaattgtttccaatgcataataccacatcgtgagcgcgagcagaccatac ttacaatcttatacttgatctgagcaggtagtttgtgcattggcgacaac cttgctcacattggaagacagctttcctcttagctcagcacagacaagat gtgtcaagaggagcccagcaagaagtgctgctgccatcaacatcgtgaac acggcactccagctctctggtgagatgtatcctgtgagcaatggcccgat tgcggcaccaaccgacccggtcccatcgatgattgctgtcacagtggcca gtgcccgagaattaccattcaatgagctgtgagtgccaaggtcagctgac actgcagttgtgatcagggcataagggaccattgacaaacatgccagtgg atgaacatgaggcaaatgttcgacatcatcgacatgcttccatatgttct gtacaagaaaaggg
Download
page-top