Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ664942
Length 644 bp
Fasta Format > whkp20m12
agattcccctacctttgctgttcatgcgaactgcttatgcaagcgataag tgcatttcctgccttggtggattttgtgatggagatcatgtcacgccttg ttaacaagcagatatggaaatatccgaagttatgggtaggattcctgaag tgtgctatcctgataaaacctcagtcctatggtgtgttactgcagttacc agctccacaactcgaaaatgccctgaataagaaccctctactgaaggcgc ccttggtcgagcatgccagccagccaaacgtgcgatcaactctcccgaga tctatcttggtggttctgggtctcgccgaagatcaacagcagcagcccgc acctgaggcacagagcagccagaaccaggccgcggagaccagcagctccg ccgcagaggccacgacggaagtaactcaggaatcctccgccgccagttga catttcccccgcagcagtgctggccttctctgtatttgctggaacagaat ggaggcatttggcaggcgacgaagtgctgcctgcattaatgtagtaccgg gaaagatggcatggcaagaccatgtggcgaagcagtgttcanctgctgcg cgatttgtataaaacatttattacgctaanaatttgaaaatagt
Download
page-top