Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ664926
Length 759 bp
Fasta Format > whkp20l15
ccttccctcctccaacaccatggcccccactgtgatggcttcctcggcca cctccgtcgcacccttccagggtctcaagtccaccgcgggcctgcccgtc agccgccgctccagcagcgccggcctcggcagcgtcagcaacggcggaag gatcaggtgcatgcaggtgtggccgattgagggcatcaagaagttcgaga ccctgtcttacttgccacccctctccacggaggccctcctgaagcaggtc gactacttgatccgctccaagtgggtgccctgcctcgagttcagcaaggt tggcttcgttttccgtgagcacaacagctcccccgggtactacgatggtc gatactggacaatgtggaagctgcctatgttcgggtgcaccgacgccaca caggtgctcaacgaggtggaggaggtcaagaaggagtaccctgacgccta tgtccgcgtcatcggcttcgacaacctgcgccaggtgcagtgcgtcagct tcatcgccttcaggccaccgggttgcgaggagtctggcaaggcctaaact acgagttgaaacaatggcctatgtatgaaggtcttttgtgaacttaactt ttgtccaccactctgctggacgaccagagcatatttttcattctatatgg tctgtgtgtgtatgtacgaacataggttctcgagcatgcatatgtaaatt ctanaaccggctacacatatacaaaacctgtgtgatatttattatataca aaaaaaaaa
Download
page-top