Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ664760
Length 756 bp
Fasta Format > whkp20c15
gtcagatggagttgatcgatgccgcatttccacttctcaagggagttgtt gcaacaactgatgttgttgaggcttgcactggtgtgaatgttgcggttat ggttggtggattccccaggaaggaaggaatggaaaggaaggatgttatga cgaaaaatgtttcaatctacaaagctcaagcatctgctcttgaagctcat gcagcccccaattgcaaggttttggttgttgccaacccagcaaacaccaa tgctctcatcctgaaggagtttgctccatctatccctgagaagaacatca gttgtttgacccgcctagaccacaacagggcactcggtcagatttctgag agacttggtgtccaagtttctgacgttaagaatgctattatctggggtaa tcactcgtccagtcagtatcctgatgttaaccatgccactgtgaagactc ccagtggagagaagcctgttcgtgaacttgttcaagatgatgaatggcta aatggggagttcattgccactgtccagcagcgtggtgctgcaatcatcaa agcgaggaagctctccagtgctctctctgctgccagctcagcttgtgatc acatccgtgactgggttctgggaaccgctgagggaacatttgtttccatg ggtgtgtactctgatggttcatacggtgtgcctgctggtcttatctactc cttcccantaacgtgcagtggtggtgaatggacaattgttcaagggctcc cgatcg
Download
page-top