Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ664365
Length 619 bp
Fasta Format > whkp19l21
aggcttttctganaagctcaaatggctcccaaagttgctgttgccnngaa gggcgatgccaaggcccaggccgccaaggttgccaaggctgtgaagtctg ggtcaatcaagaagacggcaaagaagatccncacttctgtgacatttcac cgccccaagaccctgtccaaggccngggaccccaagtaccccatgatcag cacccctggaaggaacnaattacaccagtaccnnatcctcaagtacccgc ttaccactgagtctgcgatgaagaagattgaagacaacaacacccttgtc ttcattgtcgacctcanggccgacaagaagaaaataaaggctgctgtcaa gaaaatgtatgacattcaggccaagaaggttaacaccctcatcaggcctg atggcaagaagaaggcgtacgtgaagctgacaccanactacgatgctctt gacgtggccaacaagatcggcatcatataagccagagggagggtcctgca gtaggcgcttgtgtcgtggtttcttatgttattggaattttgtagttgtt acttagcaaagggccttaatggctccattgcctaccatatcgctgcacac tttcttgaatttgatgcaa
Download
page-top