Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ664156
Length 809 bp
Fasta Format > whkp18p19
ccggcatcctcctctcctccagataatacattaccatggcccccgccgtg atggcttcctcggctaccaccgntcgcacccttccaggggctcaagtcca cagccggtctccccgtcggccgccgctccagcggcagcctcagcagcgtc agcaatggcggaaggatcaggtgcatgcaggtgtggccaattgagggcat caagaagttcgagaccctgtcttacctgccacccctatccacggaggccc tcctgaaacaggtcgactacctgatccgctcaaagtgggtgccctgcctc gagttcagcaaggttggcttcgtcttccgtgagcacaacagctcccccgg gtactacgacggccgatactggacaatgtggaagctgcctatgttcgggt gcactgacgccacacaggtgctgaacgaggtggaggaggtcaagaaggag taccctgacgcctatgtccgtgtcatcggcttcgacaacctgcgccaggt gcagtgcgtcagcttcatcgcctttaggccaccgggttgcgaggagtccg gcaaggcctaaactacgagttgaaacaatggcctatctcgtatgaaggtc ttttgtgaacttcacttttgtccaaaactctgctgtacgactctgctttc tgaccggagcataccttttgttctatatgattttgtgtatgtatgtacga acataggttcttgagcatgcatacgtaattcctcataggtctatatcttc ttcttcggcacaacccccnaatacatcaatggacnaaatctgtctatacc ttttcataa
Download
page-top