Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ664155
Length 769 bp
Fasta Format > whkp18p18
acaccatggcccccactgtgatggcttcctcggccacctccgtcgcaccc ttccagggtctcaagtccaccgcgggcctgcccgtcagccgccgctccag cagcgccggcctcggcagcgtcagcaacggcggaaggatcaggtgcatgc aggtgtggccgattgagggcatcaagaagttcgagaccctgtcttacttg ccacccctctccacggaggccctcctgaagcaggtcgactacttgatccg ctccaagtgggtgccctgcctcgagttcagcaaggttggcttcgttttcc gtgagcacaacagctcccccgggtactacgatggtcgatactggacaatg tggaagctgcctatgttcgggtgcaccgacgccacacaggtgctcaacga ggtggaggaggtcaagaaggagtaccctgacgcctatgtccgcgtcatcg gcttcgacaacctgcgccaggtgcagtgcgtcagcttcatcgccttcagg ccaccgggttgcgaggagtctggcaaggcctaaactacgagttgaaacaa tggcctatgtatgaaggtcttttgtgaacttaacttttgtccaccactct gctggacgaccagagcatatttttcattctatatggtctgtgtgtgtatg tacgaacataggttctcgagcatgcatatgtaaattctanaaccggctac acatatacaaaacctgtgtgatatttattatatacaaacacgcggaccat tgtcttgctgttattaaaa
Download
page-top