Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ664131
Length 289 bp
Fasta Format > whkp18o07
cgatctgaccggctggcgtctcagatctgctgctggtctgatgctaaacg gcggatctanatgttcccggcggtctcggtatgttgcagcggcgggcccg gaggggctctctccggcgagtacgtgggatcccgtctgctcctccacctc gttgcgacgacggccgacggctctttgtgttgataattattcgatgctat gtcgataattattanatctaanagatcggaggtgacgtaaggtaanaana tgtatcaagcnaggtgcttgtgganaggtcgnaggagag
Download
page-top