Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ663895
Length 435 bp
Fasta Format > whkp18a04
tgcctatgttcgggtgcactgacgccacacaggtgctgaacgaggtggag gaggtcaagaaggagtaccctgacgcctatgtccgtgtcatcggcttcga caacctgcgccaggtgcagtgcgtcagcttcatcgcctttaggccaccgg gttgcgaggagtccggcaaggcctaaactacgagttgaaacaatggccta tctcgtatgaaggtcttttgtgaacttcacttttgtccaaaactctgctg tacgactctgctttctgaccggagcataccttttgttctatatgattttg tgtatgtatgtacgaacataggttcttgagcatgcatacgtaattcctca taggtctatatcttcttcttcggcacaacccccgaatacatcaatggacg agatctgtctataccttttcataataaaaaaaaaa
Download
page-top