Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ663813
Length 611 bp
Fasta Format > whkp17l22
aagcctggaccacacaagatccaaggaattggagctggttttatccctgg tgtcttggatgttgacatcattgatgaaaccatacaggtttcaagtgatg agtccattgagatggcaaagtctctggcattgaaagaaggattgctggtt ggaatctcttctggtgctgctgcagcagctgcaatcaaggttgctcagag gcctgaaaatgcagggaaactctttgttgttgtattcccaagcttcggag agcgctacctttcgtcggtgctcttccactccatcaagaaggaggccgag agcatggtggtcgagtgaccctcgggactcctcaagcgcgcgaagctgtt ctccaaagccaaatccctccattcgtaggagccctccttacagaaataaa agctttggcgtccctgctagtgttggtctgacatcaagccctgtcaagct ttaatcccactttgtgtagcaatggggaatactttgtgttggccttgtgg tgtttagcagtttgaattacttcttgcctgccctgtatattgaactattc ctctgtggtccatatgtcagccagtgtgaaataaagcatcatggtgccct taaaaaaaaaa
Download
page-top