Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ663707
Length 798 bp
Fasta Format > whkp17g08
tgagcacgccccttctctctcaactttgggctcgaggcaatggcggcgct cgctccgacgaagatgctcggcacccggctcaacttcgccggctcctcca ggtacgccacagcggcaccaactgctggcgcacagaagatcgtctccctc tttgatcgcttcaagaagaagcctgccccgaagccgaagcccgcccccgt ggccacctcgagcgtaggcatcgacgacgagctcgccaagtggtacggcc ctgacaggaggatctacttgcccaacggactccttgaccggtcggaggtg ccggagtacctcaacggagaggttcccggagactacggctatgatccttt tggtctgggcaagaagccagaggacttcgccaagtaccaggcctttgagc tcatccatgccaggtgggccatgctcggcgccgccggattcatcatcccc gaggcgctcaacaagttcggcgcaaactgcggtcccgaggccgtttggtt caagactggcgcccttctccttgacggcaacaccctcaactacttcggca acagcatccccatcaacctgatcctcgccgtcgtcgccgaggtcgtcctc gtcggaggcgccgagtactacaggatcaccaacggactggaatttgatga caagctccaccccggtggcccattcnacccgctcggcctcgccaccgacc ccgaccangcggcgctgctcaaggtgaagganatcaanaacggacggctg gccatgttctccatgctgggcttcttcatccangcctacntcaccggc
Download
page-top