Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ663507
Length 754 bp
Fasta Format > whkp16k23
gatggcttcctcggccacctccgtcgcacccttccagggtctcaagtcca ccgcgggcctgcccgtcagccgccgctccagcagcgccggcctcggcagc gtcagcaacggcggaaggatcaggtgcatgcaggtgtggccgattgaggg catcaagaagttcgagaccctgtcttacttgccacccctctccacggagg ccctcctgaagcaggtcgactacttgatccgctccaagtgggtgccctgc ctcgagttcagcaaggttggcttcgttttccgtgagcacaacagctcccc cgggtactacgatggtcgatactggacaatgtggaagctgcctatgttcg ggtgcaccgacgccacacaggtgctcaacgaggtggaggaggtcaagaag gagtaccctgacgcctatgtccgcgtcatcggcttcgacaacctgcgcca ggtgcagtgcgtcagcttcatcgccttcaggccaccgggttgcgaggagt ctggcaaggcctaaactacgagttgaaacaatggcctatgtatgaaggtc ttttgtgaacttaacttttgtccaccactctgctggacgaccagagcata tttttcattctatatggtctgtgtgtgtatgtacgaacataggttctcga gcatgcatatgtaaattctanaaccggctacacatatacaaaacctgtgt gatatttattatatacaaacacgcggaccattgtcttgctgttattaaaa aaaa
Download
page-top