Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ663446
Length 711 bp
Fasta Format > whkp16h08
cacgaggaaggcgagccaaccaccaccgccgcgagactagcaccacgagc gagctcggccgattccgattccgtctgcgctattaaggtttgtttggagg aaggggaggaggttcggaggtggagctgagagagagaccggagatggcgg cttccgcgaggcagggggagagggcgaccagcttcgccatggcctgcagc ctgctcagccgctacgtccgccagaacggcgccgccgcggccgagctcgg cctcggaatcaacaagggtgaggccgaggctcacaggacggcggacacca agagccctttgcctggggcggagggcgaggaggccggcaggaagaaggag accatggagctcttcccgcagagcgccggcctgcaggacgccgccgcccc tgacnctactanggangaagacaagagccagctgaccatcttctatggtg ggaaggtgctcgtgttcaacnatttcccagccgacnaggccaatggcctg atgcagttggctggcaagggcagcccggttgctcanaacgtctctgcnac cacaactgctgcanacaccgccaaggtccanacngccgtgctggccccng caantantttgcctantgatccngttgttgctcctaantctgctcntccn aatgcttctnatctgccaattgctanaaangcntcacttcaccnattcct tnanaananaa
Download
page-top