Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ663435
Length 883 bp
Fasta Format > whkp16g18
aaaagagatgtgaacatctagaggcctttgccatgttgggtgcgctcgca tggcaggccgccaccataataaagatgtttttttgtctcggggggagatc gcacgggggttatcttgttttagccccgggttctcccccctgtgtgctgg tgtgctcctttgtccgcacccctcgtccgatccgactacatggcacaacg ttctaccgtcgcaaatcgttcatggagctaccctcgaaagaccaaaggta caattgataatttacataccgctgaaccgtacataagctttgacaaagta cctatttcattcaaaaattatcttgaattcattcagaagttacttgcatt aatatagagaaattgtacaacatcatcacaaatctgtactcgacaactac atgcagtccagcataatcaaatcttgcacatatgttcttcactcaaaatt gtgtttatttgtatgatattctgaactaaatttaagtatttctctgtatg gaaggatcatattatcctgtaagaacattttagaccctatttcttgtggt cagctgcttcataatgtaagatgtcttatgttagaaataatttatgtagc ttgaacagctgtaagtggtccgtgtattacccaaatgaagcttacagtac aattatcgctgcaccgtcgaatggatgtttctctcgttggagcttcnatg gctgaagagacgtgaagagctatttgattctggacaaatctgtgaccgtg aatttccaccggcaggatcgtcanaagtacctactaatctggaaaatcat ttattaagtcanatgtacctactaatctggaaaatcatttattaagtcan atgtacctactaatctggaaaatcattcattaa
Download
page-top