Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ663370
Length 505 bp
Fasta Format > whkp16c22
agtcaacctcaccgaggagaagcagagagaagggagaagatgtcggggcg cggcaagggaggcaaggggctcggcaagggcggcgccaagcgccatcgga aggtgctccgggacaacatccagggcatcaccaagccggcgattcgacgt ctggcacgtcggggcggcgtgaagcgcatctcggggctcatctacgagga gacccgcggcgtgctcaagatcttcctcgagaacgtcatccgcgacgccg tcacctacaccgagcacgcccgccgcaagactgtcactgccatggacgtc gtctacgcactcaagcgccagggacgcaccctctatggattcggaggcta ggctccggcgaggcgaatccagctcgcacctgctgatcagatattcagat tagcagtagctaggcgttgttcagtgttcatggtgatcgatgtaatttat gatgtatggtgcctgttcgttggaatggataaatcgctgttatttaaaaa aaaaa
Download
page-top