Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ663174
Length 827 bp
Fasta Format > whkp15i08
aggttgatttccgcaggcttatggctgatcgtcatgctctagctgaggaa cggatggagttgcacagggagttgcaagccggaaaggaggaggtctgtca ccttaacatgatcatcgcagagattaatgccaagaaggaagcttatatca gcgagctcgttgacaagagaaggaagcttgaagctgaacttagatcaaat gagcctttgagagatgaggttgtgcatcttcgtggtgaaatcgagaagct ccttgctgttaggaaagaactctctgcaaaggctgcatcactcatgcagg agctgagtagggagagatctgataaacaacagttacctatgctgaaagca gagattgagggccttcaactggaacttactcatgcaaggaatgcatgtga attggagcagaaggggaatttcgagttggtggaacaaaggaaagcaatgg agaagagtatgatttcgatggcacaagaaattcaacaaatgcgggccgaa ttagctaattttgatggcagaccatggggcacaggtggagcacatgggat gaagctgggaagtcctgaagcgaccttccctactcaatatggagataaat acaatatacatgcgggagtttctgagaaaggtccttcgcaccctcctgaa tcttcgtggggcacatttgagaagaaccgtttccagtaccgctaagatcc cagctgctacattccggggagaaagaatcacctctaggttgaatcctgag ttggtccttcctctgatgacagaagatgtatttgttcatgtgaaggagcc gtcactgccagaaaacagtaataaata
Download
page-top