Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ300035
Length 511 bp
Fasta Format > rwhsl17e09
ccgtacgtttttattnattnntattattatcttgcatgcatcgatacgag atgcagcagctggctagtggcgacacggatatacatacgacatacgtacg tataagggggcacacacacacacacacacattcaagtaggtacacagacg tatggctccatgggctagctagctgacgtacggcgagggccagctagccg tagcattccacatatgatcagcactgcctgatgcacttgcaccggcggag gggcccgtcgcagttgccgccgccccagcgttcctgcaggcagacctgcg cgcagttcttgtccgacacgcatggccccttgaaccccgcgctgcgctgc cggcagatcttcgcctccgcccccggcaccgccgncttctgtgcgatgag gaggagaagcaggaccaaaaccacctgcgtcgccaccttcttggtccaca tggtgagcggccgggctgggagcgagctaaactctgcttgcgctacgtac tggctttgttc
Download
page-top