Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ663159
Length 516 bp
Fasta Format > whkp15h15
cttatcgcctcgaacgtatcgaagccgaggagagccgccgatcgacatgg gtctcaaggaggagtttgaggagcacgcggagaaggccaagacgctgccc gacaccaccaccaacgagagcaagctctgcctctacggcctctacaagca ggccaccgtcggccccgtcaacaccgcccgccccggcggcctctttgata tggctggcaaggccaagtgggatgcttggaaggccgtcgaagccaaatcc aaggaggaggccatggctgactacatcaccaaggtgaagcagctgctgga ggaggctgccgccgcatctgcttgatcccaggccacaaaaccgcaatcgc tattgttatcctggtggtgcagccatatgtgccagcaaacacaaataagt ttcaagtactagttgttgtcaagcttatcgccgtcgtgggtgtaattacg ttgaacaagccctgtgatacatgaaagtgcaatctcagtttacaccatga ttgattaaaaaaaaaa
Download
page-top