Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ663131
Length 400 bp
Fasta Format > whkp15g02
gaaggagtaccctgacgcctatgtccgtgtcatcggcttcgacaacctgc gccaggtgcagtgcgtcagcttcatcgcctttaggccaccgggttgcgag gagtccggcaaggcctaaactacgagttgaaacaatggcctatctcgtat gaaggtcttttgtgaacttcacttttgtccaaaactctgctgtacgactc tgctttctgaccggagcataccttttgttctatatgattttgtgtatgta tgtacgaacataggttcttgagcatgcatacgtaattcctcataggtcta tatcttcttcttcggcacaacccccgaatacatcaatggacgagatctgt ctataccttttcataataaagagtaggatggtctttcaagaaaaaaaaaa
Download
page-top