Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ662986
Length 716 bp
Fasta Format > whkp14n02
cctctgccctcctcgtctccggcgcgagcgcggagggggcgcccaagagg ctgaccttcgacgagatccagagcaagacctacatggaggtgaagggtac cggcaccgcgaaccagtgcccgaccatcgacggcggcgtcgactccttcc ccttcaaggccggcaagtacgagatgaagaagttctgcctggagcccacc tccttcaccgtcaaggccgagggcatccagaagaacgagccgccggcctt ccagaagaccaagctcatgacccgtctcacctacacccttgacgagatgg aaggcccgctcgaggtcggcgccgacggcaccctcaagttcgaggagaag gacggcatcgactacgcggccgtcaccgtgcagctccccggaggcgagcg cgtgcccttcctcttcaccgtcaagcagctcgtcgccaccggcaagcccg agagcttcagcgggcccttcctcgtgcccagctacaggggttcgtctttc ctcgacccaaagggccgtggtggctctactggctacgacaacgccgtggc gctacccgccggaggcagaggagacgaggaggagttggccaagganaacg tgaanaacgcgtcctcctccacgggcaacatcacgctcancgtcaccaan ancaagccgganaccggcnaggtgatcngcgtcttcnanagcgtgcancc ntcanacaccnacctc
Download
page-top