Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ662981
Length 806 bp
Fasta Format > whkp14m18
tgatcgcttcagaagaagcctgccccgaagccgaagcccgcccccgtggc cacctcgagcgtaggcatcgacgacgagctcgccaagtggtacggccctg acaggaggatctacttgcccaacggactccttgaccggtcggaggtgccg gagtacctcaacggagaggttcccggagactacggctatgatccttttgg tctgggcaagaagccagaggacttcgccaagtaccaggcctttgagctca tccatgccaggtgggccatgctcggcgccgccggattcatcatccccgag gcgctcaacaagttcggcgcaaactgcggtcccgaggccgtttggttcaa gactggcgcccttctccttgacggcaacaccctcaactacttcggcaaca gcatccccatcaacctgatcctcgccgtcgtcgccgaggtcgtcctcgtc ggaggcgccgagtactacaggatcaccaacggactggaatttgatgacaa gctccaccccggtggcccattcgacccgctcggcctcgccaccgaccccg accaggcggcgctgctcaaggtgaaggagatcaagaacggacggctggcc atgttctccatgctgggcttcttcatccaggcctacgtcaccggcgaggg cccctttgagaacctgtgcgcgcacctcancgaccccttcggcaacaacc tgctcaccgtcatctccggcgccgccgagagggtgcccancctgtgagct ggccgttgattgcccgtccgccgccgtcngctgttgatggatcactgcnt gcnatg
Download
page-top