Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ662942
Length 462 bp
Fasta Format > whkp14k09
acctgaacgccatgaacaagctcgagaccaagaagccatggaacctgtcc ttctccttcgggcgtgccctccagcagagcaccctcaaggcctgggctgg caaggtggagaacgaggagaaggccaggaaggcgttcctggtgaggtgca aggccaactctgaggccaccctcggcacctacaagggcgatgccaccctc ggcgagggggcctctgagagcctccacgtcaaggactacaagtactgatc tgccttcggtgcggtggcctgtttgggtgtcctgcttaccagtattatcg tttggttttcagagtcttgatatatccttcggatatcgaacctagtatgg aacttgtgctctcaaaatagcttaggtagtttcgtttttggagtcgaata ccctgttactcgggtgctgcgtatcgtaaatcggagcggtggtttttgtt ctaaaaaaaaaa
Download
page-top