Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ662769
Length 802 bp
Fasta Format > whkp14a06
ccatgctcctgctcaccattcctaggattcttgagcttgctgaagagctg tgcatgccgcttgctgccgtgaagtactctcgtgggatgttcatcttccc cggcgcacagcctgctccccacaggagcttctctgaggaggttgatgtcc tgaaccgctacttcggccacctgaagtctggcggcaatgcttatgtgatc ggagacccagcgaagcctggccagaagtggcacatctactatgccaccga gcaacctgagcagcccatggtcaccctggagatgtgcatgactgggctgg acaagaagaaggcctctgtcttcttcaagactcaagctgatagccacgtt tcctgcgccaaggagatgaccaagctctctggtatctccgacatcattcc cgagatggaggtctgtgacttcgacttcgagccctgcggctactccatga acgccatcaacggatctgccgtctccaccatccatgtgacccccgaggac ggcttcagctatgcgagctacgaggtcatgggcatggacgcctccgccct ggcctacggcgacatcgtcaagagggtcctccggtgctttggcccttcag agttctctgcggcggtcaccatctttggtggccgcggccacgccgccacc tggggcaagaagctcgacgccgaggcatacgactgcaacaacgttgtgga gcangagctcccctgtggangcgtcctcatctaccanagctttaccgtga acnaanaaggttgctgtctctgccgggtcncccangtccntcttccactg ct
Download
page-top