Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ662678
Length 135 bp
Fasta Format > whkp13k15
gggagagagggaattccttcgagatcggaatncggaacaangcgggcgcg ctcgggatcggggttaccatacaatttttcccnggaacctttagtgaatg tgctaatggagtcaaagggtggcaaaaagtctagc
Download
page-top