Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ662658
Length 559 bp
Fasta Format > whkp13j11
ggatggntcgnggngcagctactcaacgtcgtgcatggtctccatggtgg ccgctatgctcctcgtancctgcgatgcggcgatatcctgcggtcaggtg acctctgccttgagcccctgcatctcctatgcacgcggnaatggcgccaa cccgcctgcggcctgctgcagcggcgtcaggagtctggccggtgcagccc gaagcaccgctgacaagcaagcagcgtgcaagtgcatcaagagcgctgct ggtgggctcaacgctggcaaggccgccggcatccctttaaagtgcgncgt cagcgtcccctacgccatcaactcatctgtggactgttctaagattcgtt gatcnaccacttcttctcatcatcgctgcatatagctccagcgatctacg ctgagtacgttgaggtcatacacatacatatacatatatatgaataantg ctctcatattatctcactgcntgacancganaggantacctacntccggc canctctgcatggcangncacactgttgtattgatgtttnnntnntcntt cnnnntntt
Download
page-top