Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ666869
Length 666 bp
Fasta Format > whkp8n16
acggatctgccgtctccaccatccatgtgacccccgaggacggcttcagc tatgcgagctacgaggtcatgggcatggacgcctccgccctggcctacgg cgacatcgtcaagagggtcctccggtgctttggcccttcagagttctctg cggcggtcaccatctttggtggccgcggccacgccgccacctggggcaag aagctcgacgccgaggcatacgactgcaacaaccttgtggagcaggagct cccctgtggaggcgtcctcatctaccagagctttaccgtgaacgaagagg ttgctgtctctgccgggtcgcccaggtccgtcttccactgcttcgaggcc gagagtgtgcacagccaccctctggtcaaggaaggcaagctcgccaacct cctcgcatggcgggcggaggaggattctctggaagagggcgcggtgctgt gcgagtgaagacatgatttgctgtcgctattccatctgtggaatttgttc tgactgtcagtttgtcgtttggttactgtgaagcagccggccaggctatt gctctctgaataaactattagctctaggtggtttgctgcgtctgccacaa tgagcgtacttctggggaaaagctgtctcgaacttataaataagcattat ttttccaaaaaaaaaa
Download
page-top